Skip to Content
Merck
All Photos(1)

Key Documents

EHU028511

Sigma-Aldrich

MISSION® esiRNA

targeting human PCK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAACTTCGGGCACTACCTGGAACACTGGCTGAGCATGGAAGGGCGCAAGGGGGCCCAGCTGCCCCGTATCTTCCATGTCAACTGGTTCCGGCGTGACGAGGCAGGGCACTTCCTGTGGCCAGGCTTTGGGGAGAATGCTCGGGTGCTAGACTGGATCTGCCGGCGGTTAGAGGGGGAGGACAGTGCCCGAGAGACACCCATTGGGCTGGTGCCAAAGGAAGGAGCCTTGGATCTCAGCGGCCTCAGAGCTATAGACACCACTCAGCTGTTCTCCCTCCCCAAGGACTTCTGGGAACAGGAGGTTCGTGACATTCGGAGCTACCTGACAGAGCAGGTCAACCAGGATCTGCCCAAAGAGGTGTTGGCTGAGCTTGAGGCCCTGGAGAGACGTGTGCACAAAATGTGACCTGAGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Elisabeth Smolle et al.
Molecular oncology, 14(11), 2853-2867 (2020-08-11)
Inhibition of glycolysis has been considered as a therapeutic approach in aggressive cancers including lung cancer. Abbreviated gluconeogenesis, mediated by phosphoenolpyruvate carboxykinase (PEPCK), was recently discovered to partially circumvent the need for glycolysis in lung cancer cells. However, the interplay
Jiangsha Zhao et al.
Oncotarget, 8(48), 83602-83618 (2017-11-16)
Tumor-initiating cells (TICs) play important roles in tumor progression and metastasis. Identifying the factors regulating TICs may open new avenues in cancer therapy. Here, we show that TIC-enriched prostate cancer cell clones use more glucose and secrete more lactate than
S Luo et al.
Oncogene, 36(25), 3609-3617 (2017-02-07)
For cancer cells to proliferate, a balance must be built between biomass-forming, glucose-metabolized intermediates and ATP production. How intrinsic glucose carbon flow regulates this balance remains unclear. Here we show that mitochondrial phosphoenolpyruvate carboxykinase (PCK2), the hub molecule linking tricarboxylic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service