Skip to Content
Merck
All Photos(1)

Key Documents

EMU206311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Spink5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGCCTGCCTTCACCATCTGTGTATATAAAGAATTCTTCAAACTCATCTTTTTACTATAGAAAATAATGCAGAGCTGTTGGTATTGGACTCACTGGTTTTCAGTCTTTCCATCTCTTTCCTTCTAGACTCAGTGATCTGAGGATGTGGAGAAGTCTCCACTCAGTCTATGCTCTGGAAATCTGATCACAATGTTGTCTATCCAGCTGCCTGTTTAATAAAAGTAGAAACTCAGCAGAACATCCTTTTGGGGATTTGTTTATGACCGCTAGATAATAGAAATATATTTTAATAGTAGCTGAATATATGGTGCCCTTTGTCTTGATTAAACACAGTGGTAGACAAGTTGCTGCCATTGTTGAAGAAGTGGGGCAAGATGGACTCTGAGGCAGCCAGTACATGTATGAAGCTACCTGTTAACATGTCAGACCCCTACCTAGTATTTGTATTTCCATAAATACCATACCTCAATTATATAAGTTTTATAGTTGACAACATCCATTACTTTCTCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Junyue Xing et al.
Molecular and cellular biology, 35(23), 4043-4052 (2015-09-24)
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service