Skip to Content
Merck
All Photos(1)

Key Documents

EMU069631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stra13

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATTTGCACTTCAGGGATTGCAAGACCAAAGTCAGCGGGGATGCACTGCAGCTCATGGCGGAGTTCCTGAGGATCTTCGTACTAGAGGCTGCTGTCCGTGGGGTCTGGCAGGCCCAGGCAGAAGACCTGGATGTTGTGGAAGTGGATCAGCTGGAGAAAGTGCTCCCTCAGCTGCTCCTGGACTTCTAGAGTTCCCTCCTGTGGCCTGCAAGGTCTAGTGAATCCACACCAGCATCAACTCCTGAGCTCTCCAGCTTCAGGAGGATGGGAAGATCCCAGCAGCTGTTACCTCCAAGAGTCCTTGCAAGACAGGTGCAGGGAAAGGTGAACCAGCCTGCCTCCAGACACAGCCCTCCTCCCGCCCCCAGCAGCCTTGCATTATAAATAAACCAGCTGCTGGCAGTGCTCCTTCTTGCCACCCTACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aarti Sethuraman et al.
Breast cancer research : BCR, 20(1), 117-117 (2018-10-05)
Metastasis is responsible for a significant number of breast cancer-related deaths. Hypoxia, a primary driving force of cancer metastasis, induces the expression of BHLHE40, a transcription regulator. This study aimed to elucidate the function of BHLHE40 in the metastatic process
Qiang Liu et al.
International journal of molecular medicine, 38(6), 1727-1733 (2016-11-15)
The functions of basic helix-loop-helix (bHLH) transcription factor-differentiated embryonic chondrocyte (DEC)1 (BHLHE40) and 2 (BHLHE41) are involved in various fields such as circadian rhythms, immune responses, cell proliferation, hypoxia reaction as well as malignant tumors. Previous findings showed that DEC served as apoptosis regulators
Rui Ning et al.
Frontiers in pharmacology, 8, 866-866 (2017-12-14)
Inflammatory burden is a primary cellular event in many liver diseases, and the overall capacity of drug elimination is decreased. PXR (pregnane X receptor) and CAR (constitutive androstane receptor) are two master regulators of genes encoding drug-metabolizing enzymes and transporters.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service