Skip to Content
Merck
All Photos(1)

Key Documents

EHU012331

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF20A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAAGCAGCAGGTTCCATCTGAGGACAGTATGGAGAAGGTGAAAGTATACTTGAGGGTTAGGCCCTTGTTACCTTCAGAGTTGGAACGACAGGAAGATCAGGGTTGTGTCCGTATTGAGAATGTGGAGACCCTTGTTCTACAAGCACCCAAGGACTCTTTTGCCCTGAAGAGCAATGAACGGGGAATTGGCCAAGCCACACACAGGTTCACCTTTTCCCAGATCTTTGGGCCAGAAGTGGGACAGGCATCCTTCTTCAACCTAACTGTGAAGGAGATGGTAAAGGATGTACTCAAAGGGCAGAACTGGCTCATCTATACATATGGAGTCACTAACTCAGGGAAAACCCACACGATTCAAGGTACCATCAAGGATGGAGGGATTCTCCCCCGGTCCCTGGCGCTGATCTTCAATAGCCTCCAAGGCCAACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stéphanie Miserey-Lenkei et al.
Nature communications, 8(1), 1254-1254 (2017-11-03)
The actin and microtubule cytoskeletons play important roles in Golgi structure and function, but how they are connected remain poorly known. In this study, we investigated whether RAB6 GTPase, a Golgi-associated RAB involved in the regulation of several transport steps
Daniela Stangel et al.
The Journal of surgical research, 197(1), 91-100 (2015-05-09)
The Translational Genome Research Network in Pancreatic Cancer performed a meta-analysis of publicly available various high-throughput gene analysis panels to identify drugable targets. There, the most differentially expressed gene between normal and cancerous pancreas was Kif20a. The aim of the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service