설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCCTGAAAAATGACGAGATAATAGATGCCACTCAAAAAGGGAATTGCTCTCGTTTCATGAATCATAGCTGTGAACCAAACTGTGAAACCCAGAAATGGACTGTGAATGGACAGCTGAGGGTTGGATTTTTTACCACCAAACTAGTTCCTTCAGGCTCAGAATTAACTTTTGACTACCAGTTCCAAAGATATGGCAAAGAAGCTCAGAAGTGTTTCTGTGGGTCAGCCAACTGCCGGGGCTACTTGGGAGGAGAAAACAGAGTCAGTATCAGAGCTGCAGGAGGGAAGATGAAAAAGGAACGCTCTCGAAAGAA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... SETD2(235626) , Setd2(235626)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Na Liu et al.
Oncology reports, 32(6), 2397-2404 (2014-10-22)
Previously, we reported that hypoxia was able to induce invasion and metastasis in gastric cancer and that hypoxia-inducible factor-1 (HIF-1) is a key factor involved in this tumor type. Krüppel-like factor 8 (KLF8) as a transcriptional repressor has been suggested
Reza K Oqani et al.
Scientific reports, 9(1), 3831-3831 (2019-03-09)
The mRNA processing and export factor, Iws1, interacts with the histone H3/H4 chaperone, Spt6 (Supt6 in mouse gene ontology) and recruits the lysine methyltransferase, Setd2, to chromatin to regulate H3K36me3. This recruitment is known to be crucial for pre-mRNA splicing
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.