콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU203261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCCAGTTTAGGTAATAAACTTTATTATGAAAGTTTTTTTTTAAAAGAAACAAAGATTCCTAGAGCGTATGCTTTGGCCAAACGTCCTGGGTTGGGAGTGGGGTATACAGACTGACTTTTCTTGAAGTCTTCGGGATGCTGGGGGGAGGGGGGAGGGTCGGACATCATATACATCTCCACCCACAGTGATGGGGACCAAACTTCCAGGCTAGTTGTGGTTTATGACTGGGAAGATGGCCGCTCCTGAGTATCCGTGCCTGGTCTCTGGTATTTCTGTGATGGGATCCTACAGGGACAGCCCCTGACACTGAGTACTGTGTTGCCCCCAGTATACAGAGGAGAAAACTGAGAGACGGGTAATTGACGACAGACCATTCCTGGACTGGAGAGGTGGGCCTTTTAACTGTCCATCCTGCATCAATTTGAAATGGATGACAGAGAGGAAACTTCTTTGCTTCTCTGACCACAACTACTTCCAGGA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hua-Bing Li et al.
Nature, 548(7667), 338-342 (2017-08-10)
N
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
Wai Po Chong et al.
Immunity, 53(2), 384-397 (2020-07-17)
Dysregulated Th17 cell responses underlie multiple inflammatory and autoimmune diseases, including autoimmune uveitis and its animal model, EAU. However, clinical trials targeting IL-17A in uveitis were not successful. Here, we report that Th17 cells were regulated by their own signature
Chulwon Kim et al.
Oncotarget, 6(6), 4020-4035 (2015-03-05)
Artesunate (ART), a semi-synthetic derivative of artemisinin, is one of the most commonly used anti-malarial drugs. Also, ART possesses anticancer potential albeit through incompletely understood molecular mechanism(s). Here, the effect of ART on various protein kinases, associated gene products, cellular

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.