추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGCAACATCAGAAGCACTCAAGATTTCCAGAGAGGTAGATCCAGATGGGCGCAGAACTCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAGCTTGGAATAATTGGAGTAGTTAACAGAAGCCAACTGGATATTAACAATAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAGTACCCATCTCTGGCCAACAGAAATGGAACAAAGTATCTTGCTAGGACCCTGAATAGGTTACTTATGCATCATATCAGAGATTGTTTACCAGAGCTGAAAACAAGAATAAATGTCTTAGCTGCTCGGTATCAGTCTCTTCTAAATAGCTATGGTGAACCGGTGGATGATAAAAGTGCTACTTTACTCCAGCTTATTACCAAATTTGCCACAGAGTATTGTAACACGATTGAAGGAACCGCAAAGTACA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... DNM1L(74006) , Dnm1l(74006)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Bharathi Aravamudan et al.
American journal of physiology. Lung cellular and molecular physiology, 306(9), L840-L854 (2014-03-13)
The balance between mitochondrial fission and fusion is crucial for mitochondria to perform its normal cellular functions. We hypothesized that cigarette smoke (CS) disrupts this balance and enhances mitochondrial dysfunction in the airway. In nonasthmatic human airway smooth muscle (ASM)
Mabel Lum et al.
International journal of medical microbiology : IJMM, 304(5-6), 530-541 (2014-04-24)
Shigella infection in epithelial cells induces cell death which is accompanied by mitochondrial dysfunction. In this study the role of the mitochondrial fission protein, Drp1 during Shigella infection in HeLa cells was examined. Significant lactate dehydrogenase (LDH) release was detected
Jing Zhou et al.
Autophagy, 11(8), 1259-1279 (2015-06-27)
Autophagy inhibition has been widely accepted as a promising therapeutic strategy in cancer, while the lack of effective and specific autophagy inhibitors hinders its application. Here we found that liensinine, a major isoquinoline alkaloid, inhibits late-stage autophagy/mitophagy through blocking autophagosome-lysosome
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.