콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU084221

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnm1l

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGCAACATCAGAAGCACTCAAGATTTCCAGAGAGGTAGATCCAGATGGGCGCAGAACTCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAGCTTGGAATAATTGGAGTAGTTAACAGAAGCCAACTGGATATTAACAATAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAGTACCCATCTCTGGCCAACAGAAATGGAACAAAGTATCTTGCTAGGACCCTGAATAGGTTACTTATGCATCATATCAGAGATTGTTTACCAGAGCTGAAAACAAGAATAAATGTCTTAGCTGCTCGGTATCAGTCTCTTCTAAATAGCTATGGTGAACCGGTGGATGATAAAAGTGCTACTTTACTCCAGCTTATTACCAAATTTGCCACAGAGTATTGTAACACGATTGAAGGAACCGCAAAGTACA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bharathi Aravamudan et al.
American journal of physiology. Lung cellular and molecular physiology, 306(9), L840-L854 (2014-03-13)
The balance between mitochondrial fission and fusion is crucial for mitochondria to perform its normal cellular functions. We hypothesized that cigarette smoke (CS) disrupts this balance and enhances mitochondrial dysfunction in the airway. In nonasthmatic human airway smooth muscle (ASM)
Mabel Lum et al.
International journal of medical microbiology : IJMM, 304(5-6), 530-541 (2014-04-24)
Shigella infection in epithelial cells induces cell death which is accompanied by mitochondrial dysfunction. In this study the role of the mitochondrial fission protein, Drp1 during Shigella infection in HeLa cells was examined. Significant lactate dehydrogenase (LDH) release was detected
Jing Zhou et al.
Autophagy, 11(8), 1259-1279 (2015-06-27)
Autophagy inhibition has been widely accepted as a promising therapeutic strategy in cancer, while the lack of effective and specific autophagy inhibitors hinders its application. Here we found that liensinine, a major isoquinoline alkaloid, inhibits late-stage autophagy/mitophagy through blocking autophagosome-lysosome

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.