설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGGCTGTACTACGATGCAATCTGGGCCTTTGCCAACAATGAGCTTTTCGTCTCTGGCCCCAACGGCACAGCTGGAATCTTTGCCACCTATCCCTCTGGACACTTGGACATGGTCAATGGCTTCTTTGATCAGTTCATAGGCACAGCGCCCTTATTGTGTGTACTGGCCATCGTTGACCCTTATAACAACCCTGTGCCCCGTGGCCTGGAGGCTTTCACTGTGGGCCTGGTGGTCCTGGTCATTGGAACCTCCATGGGCTTCAATTCTGGCTATGCCGTCAACCCTGCCCGTGACTTTGGACCTCGCCTCTTCACCGCCCTGGCTGGCTGGGGCTCAGAAGTCTTCACGACTGGCCGGCACTGGTGGTGGGTACCCATTGTCTCCCCACTCCTGGGTTCCATCGCTGGTGTCTTCGTGTACCAGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... AQP3(11828) , Aqp3(11828)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ya-Jing Tan et al.
Scientific reports, 5, 17741-17741 (2015-12-05)
Hyperosmotic stress may induce apoptosis of different cells. However, oocytes show tolerance to osmotic stress during cryopreservation by vitrification, which is an assisted reproductive technique. The underlying mechanism is still not understood. Here, we demonstrated that hyperosmosis produced by high
Hui Xia et al.
Experimental physiology, 99(7), 974-984 (2014-05-08)
Non-small cell lung cancer (NSCLC) is one of the most common diseases encountered in medical oncology practice. The aim of the present study was to test the antitumour effects of short-hairpin RNA targeting aquaporin 3 (AQP3) in experimental NSCLC. Expression of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.