설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGGAAAAGAAGCCTTTCTGCGTCTGCCCACATAGTGCTCTTTAGCCAGTATCTGTAAATACCTCAGTAATATGGGTCCTTTCAGTTTCCAGCCATGCATTCCTGATACAATCCAGTGGTACTTCAGATCCTGTTTTAATTTGCACAAATTTAAGTGTAGAAAGCCCCTATGCCCTTCATCATACCACTGCCCTCCAAATCTACTCTTCTTTTAAGCAATATGATGTGTAGATAGAGCATGACTGAAATGTATTGTATCACACCGTTGTATATACCAGTATGCTAAAGATTTATTTCTAGTTTGTGTATTTGTATGTTGTAAGCGTTTCCTAATCTGTGTATATCTAGATGTTTTTAATAAGATGTTCTATTTTAAACTATGTAAATTGACTGAGATATAGGAGAACTGATAATATATTATATGGTAAATATAGTATCGTCTGCATTCCAGCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... SYT1(20979) , Syt1(20979)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Changping Gu et al.
Shock (Augusta, Ga.), 44(1), 83-89 (2015-03-24)
Recombinant human annexin A5 (Anx5) is known to protect cardiac function during endotoxemia, although the underlying mechanisms have yet to be elucidated. In this study, we demonstrated that Anx5 could repair the disrupted cardiomyocyte adherens junctions and improve the myocardial
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Y Loriot et al.
Cell death & disease, 5, e1423-e1423 (2014-09-19)
Radiotherapy has a critical role in the treatment of small-cell lung cancer (SCLC). The effectiveness of radiation in SCLC remains limited as resistance results from defects in apoptosis. In the current study, we investigated whether using the Bcl-2/Bcl-XL inhibitor S44563
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.