설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGAGAAATGCCACTGTGTTTTCCATTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACACGTGTCTATGACGTGCACACCTGCAAGTAGGAGAGCTCCTAACACGGGAGCAGGGTTCATTCCGAGGGGCAAGGTTCCTACCTGGGGGCGGGGTTCCTACTTGGAGGGGTCTCTTACTTGGGGACTCGGTTCTTACTTGAGGGCGGAGATCCTACCTGTGAGGGTCTCATACCTAAGGACCCGGTTTCTGCCTTCAGCCTGGGCTCCTATTTGGGATCTGGGTTCCTTTTTAGGGGAGAAGCTCCTGTCTGGGATACGGGTTTCTGCCCGAGGGTGGGGCTCCACTTGGGGATGGAATTCCAATTTGGGCCGGAAGTCCTACCTCAATGGCTTGGACTCCTCTCTTGACCCGACAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... WNT3A(22416) , Wnt3a(22416)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Hui Xu et al.
Oncology reports, 41(2), 1180-1188 (2018-11-16)
Fine particulate matter (PM2.5) is associated with an increased lung cancer risk. However, the effect of PM2.5 exposure on lung cancer cells is still largely unknown. The present study revealed that A549 lung cancer cells secreted exosomes containing high levels
Yan Xia Yu et al.
American journal of cancer research, 7(11), 2144-2156 (2017-12-09)
Therapeutic antibodies targeting colony stimulating factor 1 receptor (CSF-1R) to block colony stimulating factor-1/colony stimulating factor 1 receptor (CSF-1/CSF-R) signaling axis have exhibit remarkable efficacy in the treatment of malignant tumor. Yet, little is known about the effects of intrinsic
Jaewoong Jang et al.
Scientific reports, 7, 41612-41612 (2017-01-28)
In this study, LPS-induced inflammatory responses in BEAS-2B human bronchial epithelial cells and human umbilical vein endothelial cell (HUVEC)s were found to be prevented by Dickkopf-1 (DKK-1), a secreted Wnt antagonist, and LGK974, a small molecular inhibitor of the Wnt
Weifeng Zou et al.
Respiratory physiology & neurobiology, 221, 1-10 (2015-10-17)
A deficiency of surfactant proteins A and D has been proposed as a mechanism in airway remodeling, which is one characteristic of chronic obstructive pulmonary disease (COPD). We recently showed that in vitro nicotine exposure induces Wnt3a/β-catenin activation, which is
Fei Han et al.
Scientific reports, 9(1), 16861-16861 (2019-11-16)
The Wnt/β-catenin pathway is one of the most conserved signaling pathways across species with essential roles in development, cell proliferation, and disease. Wnt signaling occurs at the protein level and via β-catenin-mediated transcription of target genes. However, little is known
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.