설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAATTTGACCCAAATGCCAAAAAAGTGACCCACATATTGAAGAGCAATAGCTGGTTTAATTGTTAAAAAGAGATCCAAGGAAGGCATCCTGTGTTTTAACTGATGCTTATAGTTCTTCATCTGAGTCTTTGTGAAAGGAAGTGCTTTGTTCAGCATGTGCTATGGCAGAACCAAACAGGAGCTATGGATGACACCAGTCAACGTCAAGTTGTCAAAGGATGTTCAGAAGCACTGTGTAGCTTACACTGTGTCCCAAGGAGAGGAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MMP3(17392) , Mmp3(17392)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Nobuaki Ozeki et al.
Bioscience trends, 9(3), 160-168 (2015-07-15)
Although it is known that inorganic polyphosphate [Poly(P)] induces differentiation of osteoblasts, there are few reports concerning its effects on cell proliferation, especially in fibroblasts. Because we found that Poly(P) stimulates the proliferation of purified rat dental pulp fibroblast-like cells
Jee Youn Lee et al.
The American journal of pathology, 184(11), 2985-3000 (2014-10-19)
After spinal cord injury (SCI), blood-spinal cord barrier (BSCB) disruption by matrix metalloproteinases (MMPs) leads to BSCB permeability and blood cell infiltration, contributing to permanent neurological disability. Herein, we report that MMP-3 plays a critical role in BSCB disruption after
Debarati Banik et al.
Oncotarget, 6(17), 15164-15179 (2015-05-27)
Interferon regulatory factor-8 (IRF8), originally identified as a leukemic tumor suppressor, can also exert anti-neoplastic activities in solid tumors. We previously showed that IRF8-loss enhanced tumor growth, which was accompanied by reduced tumor-cell susceptibility to apoptosis. However, the impact of
N Ozeki et al.
Oral diseases, 20(5), 505-513 (2013-08-02)
Matrix metalloproteinase (MMP)-3 expression increases after pulpectomy and accelerates angiogenesis in rat dental pulp by an uncharacterised mechanism. Odontoblasts, a major component of dental pulp, could represent a therapeutic target. We investigated whether MMP-3 activity is induced by cytokines and/or
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.