콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU023861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nampt

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCACCGACTCGTACAAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGGAAGGTGAAATACGAGGAAACAGTATTTTATGGGTTGCAGTACATTCTTAATAAGTACTTAAAAGGTAAAGTAGTGACCAAAGAGAAAATCCAGGAGGCCAAAGAAGTGTACAGAGAACATTTCCAAGATGATGTCTTTAACGAAAGAGGATGGAACTACATCCTTGAGAAATACGATGGTCATCTCCCGATTGAAGTAAAGGCTGTTCCCGAGGGCTCTGTCATCCCCAGAGGGAACGTGCTGTTCACAGTGGAAAACACAGACCCAGAGTGCTACTGGCTTACCAATTGGATTGAGACTATTCTTGTTCAGTCCTGGTATCCAATTACAGTGGCCACAA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xu He et al.
Experimental cell research, 352(1), 45-52 (2017-02-06)
Decreased bone volume and strength with aging and enhanced risk of fractures are in part due to reduced number of bone-forming mesenchymal stem cells (MSCs) and cellular dysfunction. In a previous study, we found that osteogenic differentiation of the multipotent
Min Ling et al.
Cell & bioscience, 7, 27-27 (2017-05-27)
Bone degenerative disorders like osteoporosis may be initiated by age-related shifts in anabolic and catabolic responses that control bone homeostasis. Although there are studies suggesting that metabolic changes occur with stem cell differentiation, the molecular mechanisms governing energy metabolism and
Xia Wang et al.
Scientific reports, 5, 12657-12657 (2015-08-01)
Nicotinamide phosphoribosyltransferase (NAMPT) is a promising antitumor target. Novel NAMPT inhibitors with diverse chemotypes are highly desirable for development of antitumor agents. Using high throughput screening system targeting NAMPT on a chemical library of 30000 small-molecules, we found a non-fluorescent
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.