설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATCGAACAGATCGACAGCAGCATGTACCCGGGGCTGATCTGGGAAAATGATGAGAAGACCATGTTCCGTATCCCCTGGAAGCATGCCGGCAAGCAGGATTACAATCAGGAGGTGGATGCTTCCATCTTCAAGGCCTGGGCAGTTTTTAAAGGGAAGTTTAAAGAGGGAGACAAAGCTGAACCAGCCACGTGGAAGACGAGGTTACGCTGTGCTCTGAACAAGAGCCCAGATTTTGAAGAAGTGACTGACCGGTCCCAGCTGGACATTTCTGAGCCATATAAAGTTTACCGAATTGTCCCCGAGGAAGAACAAAAATGCAAGCTGGGCGTGGCACCTGCAGGCTGCATGAGCGAAGTTCCTGAGATGGAGTGTGGCCGCTCAGAGATTGAGGAGCTGATCAAGGAACCTTCTGTGGATGAGTACATGGGTATGACCAAGAGGAGCCCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... IRF8(15900) , Irf8(15900)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Chunyuan Guo et al.
Kidney international, 92(5), 1194-1205 (2017-07-16)
DNA methylation is an epigenetic mechanism that regulates gene transcription without changing primary nucleotide sequences. In mammals, DNA methylation involves the covalent addition of a methyl group to the 5-carbon position of cytosine by DNA methyltransferases (DNMTs). The change of
Ji-Ye Kee et al.
BMC cancer, 14, 949-949 (2014-12-17)
Inhibition of metastasis through upregulation of immune surveillance is a major purpose of chemokine gene therapy. In this study, we focused on a membrane-bound chemokine CXCL16, which has shown a correlation with a good prognosis for colorectal cancer (CRC) patients.
Takuya Yashiro et al.
Scientific reports, 9(1), 1161-1161 (2019-02-06)
The chemokine CCL22 is predominantly produced by dendritic cells (DCs) and macrophages. CCL22 acts on CCR4-expressing cells including Th2 and Treg. Although a correlation between the CCL22-CCR4 axis and allergic diseases has been established, the mechanism of monocyte lineage-specific Ccl22
Makoto Horiuchi et al.
Journal of neuroinflammation, 8, 8-8 (2011-01-26)
Administration of exogenous interferon-γ (IFNγ) aggravates the symptoms of multiple sclerosis (MS), whereas interferon-β (IFNβ) is used for treatment of MS patients. We previously demonstrated that IFNγ induces apoptosis of oligodendroglial progenitor cells (OPCs), suggesting that IFNγ is more toxic
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.