콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU016021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Smad4

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACAAGGTGGGGAAAGTGAAACCTTTGCAAAAAGAGCAATTGAGAGTTTGGTAAAGAAGCTGAAAGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAGTGTGTCACCATACAGAGAACATTGGATGGACGACTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTGTGGAGGTGGCCTGATCTACACAAGAATGAACTAAAGCATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAGCGGGTTGTCTCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCAAGTATGTTAGTGAAGGATGAGTACGTTCACGACTTTGAAGGACAGCCGTC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Kwangho Kim et al.
Molecular and cellular biochemistry, 407(1-2), 143-149 (2015-06-07)
Bioflavonoids are known to induce cardioprotective effects by inhibiting vascular smooth muscle cell (VSMC) proliferation and migration. Kaempferol has been shown to inhibit VSMC proliferation. However, little is known about the effect of kaempferol on VSMC migration and the underlying
Jennifer C Bailey et al.
Immunology, 143(4), 679-691 (2014-07-06)
CD1d-mediated lipid antigen presentation activates a subset of innate immune lymphocytes called invariant natural killer T (NKT) cells that, by virtue of their potent cytokine production, bridge the innate and adaptive immune systems. Transforming growth factor (TGF-β) is a known

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.