설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATCCTCACCGTGGCATACTACCTGTGGACTACCTTTCTGGCTGTTGTTGTGGGCATCATCATGGTCTCCATCATCCACCCTGGTGGTGCAGCACAGAAGGAGACAACTGAACAGAGTGGAAAGCCGGTCATGAGCTCAGCTGATGCCCTCCTGGATCTTGTCCGGAACATGTTCCCAGCCAACCTGGTAGAAGCCACGTTCAAACAGTACCGCACCAAGACCACCCCAGTTATCAAGTCTCCCAGGGGAGCAGCGGAGGAGGCTCCCCGGCGGATCGTCATCTATGGGGTCCAGGAAGACAATGGCTCACGTGTGCAGAACTTTGCCCTGGATCTGACGCCCCCACCTGAGATTGTCTACAAGTCAGAGCCTGGTACCAGTGATGGCATGAACGTGCTAGGCATTGTCATCTTCTCAGCCACG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... SLC1A7(242607) , Slc1a7(242607)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Aoula Al-Zebeeby et al.
Haematologica, 104(5), 1016-1025 (2018-11-24)
BH3 mimetics are novel targeted drugs with remarkable specificity, potency and enormous potential to improve cancer therapy. However, acquired resistance is an emerging problem. We report the rapid development of resistance in chronic lymphocytic leukemia cells isolated from patients exposed
Michael L Schulte et al.
Nature medicine, 24(2), 194-202 (2018-01-16)
The unique metabolic demands of cancer cells underscore potentially fruitful opportunities for drug discovery in the era of precision medicine. However, therapeutic targeting of cancer metabolism has led to surprisingly few new drugs to date. The neutral amino acid glutamine
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.