콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU012511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Slc1a7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GATCCTCACCGTGGCATACTACCTGTGGACTACCTTTCTGGCTGTTGTTGTGGGCATCATCATGGTCTCCATCATCCACCCTGGTGGTGCAGCACAGAAGGAGACAACTGAACAGAGTGGAAAGCCGGTCATGAGCTCAGCTGATGCCCTCCTGGATCTTGTCCGGAACATGTTCCCAGCCAACCTGGTAGAAGCCACGTTCAAACAGTACCGCACCAAGACCACCCCAGTTATCAAGTCTCCCAGGGGAGCAGCGGAGGAGGCTCCCCGGCGGATCGTCATCTATGGGGTCCAGGAAGACAATGGCTCACGTGTGCAGAACTTTGCCCTGGATCTGACGCCCCCACCTGAGATTGTCTACAAGTCAGAGCCTGGTACCAGTGATGGCATGAACGTGCTAGGCATTGTCATCTTCTCAGCCACG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Aoula Al-Zebeeby et al.
Haematologica, 104(5), 1016-1025 (2018-11-24)
BH3 mimetics are novel targeted drugs with remarkable specificity, potency and enormous potential to improve cancer therapy. However, acquired resistance is an emerging problem. We report the rapid development of resistance in chronic lymphocytic leukemia cells isolated from patients exposed
Michael L Schulte et al.
Nature medicine, 24(2), 194-202 (2018-01-16)
The unique metabolic demands of cancer cells underscore potentially fruitful opportunities for drug discovery in the era of precision medicine. However, therapeutic targeting of cancer metabolism has led to surprisingly few new drugs to date. The neutral amino acid glutamine
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.