콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU010551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Spp1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCTGATGAGACCGTCACTGCTAGTACACAAGCAGACACTTTCACTCCAATCGTCCCTACAGTCGATGTCCCCAACGGCCGAGGTGATAGCTTGGCTTATGGACTGAGGTCAAAGTCTAGGAGTTTCCAGGTTTCTGATGAACAGTATCCTGATGCCACAGATGAGGACCTCACCTCTCACATGAAGAGCGGTGAGTCTAAGGAGTCCCTCGATGTCATCCCTGTTGCCCAGCTTCTGAGCATGCCCTCTGATCAGGACAACAACGGAAAGGGCAGCCATGAGTCAAGTCAGCTGGATGAACCAAGTCTGGAAACACACAGACTTGAGCATTCCAAAGAGAGCCAGGAGAGTGCCGATCAGTCGGATGTGATCGATAGTCAAGCAAGTTCCAAAGCCAGCCTGGAACATCAGAGCCACAA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
Karl Blirando et al.
Digestive diseases and sciences, 60(6), 1633-1644 (2015-01-13)
Radiation damage to the normal gut is a dose-limiting factor in the application of radiation therapy to treat abdominal and pelvic cancers. All tissue cell types react in concert to orchestrate an acute inflammatory reaction followed by a delayed chronic
Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.