추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTGAGCTTCACCAGTGCAAACTGCAGCCACCAAGTACAGCAAGAAATGGCCACTACTTTTGCTCGACTGTGCCAACAAGTTGATGTTACTCAGAAACATCTGGAAGAGGAAATTGCAAGATTATCCAAAGAGATAGACCAACTGGAGAAAATACAGAACAACTCAAAGCTCTTAAGAAATAGAGCTGTTCAACTTGAAAGTGAGCTGGAGAATTTTTCGAAGCAGTTTCTACACCCGAGCAGTGGAGAATCCTAACGGCAGAGGCACTGTAGGAGGAAGCGGACTTGGAAGATGGGAAATGTTACTTTATGAAATGACCTCAGTACAAGTTACTAACTCTTAGTATCGATGCCTTGCGGAGATTGTGGTAATGACCTGTCTCAGGGGTTGCACCTTTGGAAGTGTTGTGATTCGCCT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MFN1(67414) , Mfn1(67414)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Sarah L Sawyer et al.
Human molecular genetics, 24(18), 5109-5114 (2015-06-19)
Multiple symmetric lipomatosis (MSL) is a mitochondrial disorder with impaired brown fat metabolism that has been associated with MERRF mutations in some, but not all, patients. We studied a sibling pair and an unrelated indiviadual who presented with MSL and
Qian Zhou et al.
Vascular pharmacology, 72, 163-171 (2015-05-28)
Angiogenesis is defined as the sprouting of capillaries from pre-existing vasculature. It is a complex process that includes endothelial proliferation, migration, and tube formation. Previous data have demonstrated a high expression level of manganese-superoxide dismutase (MnSOD) in endothelial cells and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.