콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU152551

Sigma-Aldrich

MISSION® esiRNA

targeting human LDLR

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCACAACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCGTGAACATCTGCCTGGAGTCCCGTCCCTGCCCAGAACCCTTCCTGAGACCTCGCCGGCCTTGTTTTATTCAAAGACAGAGAAGACCAAAGCATTGCCTGCCAGAGCTTTGTTTTATATATTTATTCATCTGGGAGGCAGAACAGGCTTCGGACAGTGCCCATGCAATGGCTTGGGTTGGGATTTTGGTTTCTTCCTTTCCTCGTGAAGGATAAGAGAAACAGGCCCGGGGGGACCAGGATGACACCTCCATTTCTCTCCAGGAAGTTTTGAGTTTCTCTCCACCGTGACACAATCCTCAAACATGGAAGATGAAAGGGGAGGGGATGTCAGGCCCAGAGAAGCAAGTGGCTTTCAACACACAACAGCAGATGGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xue-Hai Liang et al.
Nucleic acids research, 45(16), 9528-9546 (2017-09-22)
A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting
E J Gallagher et al.
Oncogene, 36(46), 6462-6471 (2017-08-02)
Obesity is associated with an increase in cancer-specific mortality in women with breast cancer. Elevated cholesterol, particularly low-density lipoprotein cholesterol (LDL-C), is frequently seen in obese women. Here, we aimed to determine the importance of elevated circulating LDL, and LDL
Kentaro Gokita et al.
Molecular therapy. Nucleic acids, 19, 330-338 (2019-12-27)
MicroRNAs (miRNAs) are endogenous small noncoding RNAs that negatively regulate gene expression by interfering with the translation or stability of target transcripts. Some tumor-suppressive miRNAs can concurrently target multiple cancer-promoting genes and may be useful as therapeutic anticancer agents. However
Jinkuk Choi et al.
Science translational medicine, 7(314), 314ra184-314ra184 (2015-11-20)
Apolipoprotein E (ApoE) is an important modifier of Alzheimer's disease (AD) pathogenesis, and its abundance has been linked to the clearance of β-amyloid (Aβ) in the brain. The pathways that control the clearance of ApoE in the brain are incompletely

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.