추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PPARA(5465) , PPARA(5465)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
E Di Giacomo et al.
Cell cycle (Georgetown, Tex.), 16(1), 59-72 (2016-11-20)
PPARs are a class of ligand-activated transcription factors belonging to the superfamily of receptors for steroid and thyroid hormones, retinoids and vitamin D that control the expression of a large number of genes involved in lipid and carbohydrate metabolism and
Maja Grabacka et al.
Archives of dermatological research, 309(3), 141-157 (2017-01-14)
Recent studies revealed the cooperation between peroxisome proliferator-activated receptor gamma (PPARγ) and α-MSH signaling, which results in enhanced melanogenesis in melanocytes and melanoma cells. However, the agonists of PPARα, such as fenofibrate, exert depigmenting effect. Therefore, we aimed to check
Tânia Vieira Madureira et al.
Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 229, 1-9 (2018-12-12)
The crosstalk between peroxisome proliferator-activated receptor α (PPARα) and estrogenic pathways are shared from fish to humans. Salmonid fish had an additional genome duplication, and two PPARα isoforms (PPARαBa and PPARαBb) were previously identified. Since a negative regulation between estrogen
Hsu-Lung Jen et al.
Journal of atherosclerosis and thrombosis, 24(5), 508-517 (2016-09-16)
Previous studies demonstrated that endothelin-1 (ET-1) can significantly increase the cell size and stimulate adiponectin expression in cultured human cardiomyocytes (HCM). The aim of the present study was to investigate the effects of fenofibrate, a peroxisome proliferator-activated receptor-α (PPARα) activator
Sun Ah Ham et al.
Oncotarget, 8(55), 94091-94103 (2017-12-08)
Migration and invasion of cancer cells into surrounding tissue is a key stage of cancer metastasis. Here, we show that peroxisome proliferator-activated receptor (PPAR) δ regulates migration and invasion of human breast cancer cells via thrombospondin-1 (TSP-1) and its degrading
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.