콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU136431

Sigma-Aldrich

MISSION® esiRNA

targeting human NRGN

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAGGCCAGAAGAACTGAGCATTTTCAAAGTTCCCGAGGAGAGATGGATGCCGCGTCCCCTTCGCAGCGACGAGACTTCCCTGCCGTGTTTGTGACCCCCTCCTGCCCAGCAACCTGCCAGCTACAGGAGCCCCCTGCGTCCCAGAGACTCCCTCACCCAGGCAGGCTCCGTCGCGGAGTCGCTGAGTCCGTGCCCTTTTAGTTAGTTCTGCAGTCTAGTATGGTCCCCATTTGCCCTTCCACTCCACCCCACCCTAAACCATGCGCTCCCAATCTTCCTTCTTTTGCTTCTCGC

Ensembl | 인체 수납 번호

ENSG00000154146

NCBI 수납 번호

NM_001126181

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NRGN(4900) , NRGN(4900)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Colin Watanabe et al.
RNA biology, 13(1), 25-33 (2016-01-21)
Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional
Mariana Marin et al.
Viruses, 11(2) (2019-01-30)
The HIV-1 entry pathway into permissive cells has been a subject of debate. Accumulating evidence, including our previous single virus tracking results, suggests that HIV-1 can enter different cell types via endocytosis and CD4/coreceptor-dependent fusion with endosomes. However, recent studies
Mirko Theis et al.
Journal of biomolecular screening, 20(8), 1018-1026 (2015-04-26)
Broad sequencing enterprises such as the FANTOM or ENCODE projects have substantially extended our knowledge of the human transcriptome. They have revealed that a large portion of genomic DNA is actively transcribed and have identified a plethora of novel transcripts.
Deanna M Santer et al.
Journal of immunological methods, 445, 15-22 (2017-03-10)
Type III interferons (IFN-lambdas) are important antiviral cytokines that also modulate immune responses acting through a unique IFN-λR1/IL-10R2 heterodimeric receptor. Conflicting data has been reported for which cells express the IFN-λR1 subunit and directly respond to IFN-λs. In this study
Isabel Weinheimer et al.
The Journal of general virology, 95(Pt 2), 486-495 (2013-11-05)
Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus, family Closteroviridae) causes heavy yield losses in sweet potato plants co-infected with other viruses. The dsRNA-specific class 1 RNase III-like endoribonuclease (RNase3) encoded by SPCSV suppresses post-transcriptional gene silencing and eliminates antiviral
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.