설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTGCACCGAAGCATCTTATTTTATAGTATATCAACCTTTTGTTTTTAAATTGACCTGCCAAGGTAGCTGAAGACCTTTTAGACAGTTCCATCTTTTTTTTTAAATTTTTTCTGCCTATTTAAAGACAAATTATGGGACGTTTGTAGAACCTGAGTATTTTTCTTTTTACCAGTTTTTTAGTTTGAGCTCTTAGGTTTATTGGAGCTAGCAATAATTGGTTCTGGCAAGTTTGGCCAGACTGACTTCAAAAAATTAATGTGTATCCAGGGACATTTTAAAAACCTGTACACAGTGTTTATTGTGGTTAGGAAGCAATTTCCCAATGTACCTATAAGAAATGTGCATCAAGCCAGCCTGACCAACATGGTGAAACCCCATCTGTACTAAACATAAAAAAATTAGCCTGGCATGGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RBM3(5935) , RBM3(5935)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Delphine Laustriat et al.
Molecular therapy. Nucleic acids, 4, e262-e262 (2015-11-04)
Major physiological changes are governed by alternative splicing of RNA, and its misregulation may lead to specific diseases. With the use of a genome-wide approach, we show here that this splicing step can be modified by medication and demonstrate the
Spatiotemporal profile and essential role of RBM3 expression after spinal cord injury in adult rats.
Zhiming Cui et al.
Journal of molecular neuroscience : MN, 54(2), 252-263 (2014-03-29)
Hypoxia and other adverse conditions are usually encountered by rapidly growing cells. The RNA-binding motif protein 3 (RBM3) is induced by low temperature and hypoxia. However, its expression and function in spinal cord injury are still unclear. To investigate the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.