콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU132901

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT6

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAGGGTGGGGCTTTTTGTAGAAACTGTGGATTCTTTTTCTCTCGTGGTCTCACTTTGTTACTTGTTTCTGTCCCCGGGAGCCTCAGGGCTCTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCCTCCCTGGGCTCCAGGGGCCTCTGGTGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTGAGCCCCTGCCACACCCCAGCCTCTGACTTGCTGTGTTGTCCAGAGGTGAGGCTGGGCCCTCCCTGGTCTCCAGCTTAAACAGGAGTGAACTCCCTCTGTCCCCAGGGCCTCCCTTCTGGGCCCCCTACAGCCCACCCTACCCCTCCTCCATGGGCCCTGCAGGAGGGGAGACCCACCTTGAAGTGGGGGATCAGTAGAGGCTTGCACTGCCTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ning Qu et al.
International journal of oncology, 50(5), 1683-1692 (2017-04-11)
Sirtuin 6 (SIRT6) is a member of the SIRT family NAD+‑dependent deacetylases reported to function in controlling organism homeostasis, lifespan, and diseases. This study investigated the role of SIRT6 in papillary thyroid cancer (PTC). Data of 391 PTC patients was extracted
Ming-Yue Cheng et al.
American journal of translational research, 8(11), 5005-5015 (2016-12-03)
The present study explored changes of the SIRT6/NF-κB pathway in myocardial hypoxia/reoxygenation induced injury and the effects on mitochondrial damage and myocardial damage by regulating SIRT6. SIRT6 expression decreased and NF-κB expression increased in H9c2 cells during hypoxic injury. Cell
Ganye Zhao et al.
Aging, 8(10), 2308-2323 (2016-10-31)
Sirtuin6(SIRT6) has been implicated as a key factor in aging and aging-related diseases. However, the role of SIRT6 in cellular senescence has not been fully understood. Here, we show that SIRT6 repressed the expression of p27Kip1 (p27) in cellular senescence.
Benjamin A Harlan et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7084-7091 (2019-03-08)
Sirtuins (SIRTs) are NAD+-dependent deacylases that play a key role in transcription, DNA repair, metabolism, and oxidative stress resistance. Increasing NAD+ availability regulates endogenous SIRT activity, leading to increased resistance to oxidative stress and decreased mitochondrial reactive oxygen production in
Yujuan Yang et al.
European journal of pharmacology, 859, 172516-172516 (2019-07-03)
Angiotensin II (Ang II) is a vasoactive peptide that elevates arterial blood pressure and leads to hypertension. Ang II has been reported to induce endothelial dysfunction by induction of apoptosis and oxidative stress in vascular endothelial cells. Sirtuin6 (SIRT6) has

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.