설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGCACAAGCTGTGGAAGAGATGGATTGGCTCCTCCCAACTGATATCCAGGCTGAATCTATCCCATTGATCTTAGGAGGAGGTGATGTACTTATGGCTGCAGAAACAGGAAGTGGCAAAACTGGTGCTTTTAGTATTCCAGTTATCCAGATAGTTTATGAAACTCTGAAAGACCAACAGGAAGGCAAAAAAGGAAAAACAACAATTAAAACTGGTGCTTCAGTGCTGAACAAATGGCAGATGAACCCATATGACAGAGGATCTGCTTTTGCAATTGGGTCAGATGGTCTTTGTTGTCAAAGCAGAGAAGTAAAGGAATGGCATGGGTGTAGAGCTACTAAAGGATTAATGAAAGGGAAACACTACTATGAAGTATCCTGTCATGACCAAGGGTTATGCAGGGTCGGGTGGTCTACCATGCAGGCCTCTTTGGACCTAGGTACTGACAAGTTTGGATTTGGCTTTGGTGGAACAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DDX1(1653) , DDX1(1653)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Qiao Xue et al.
Virologica Sinica, 34(6), 610-617 (2019-07-31)
Foot-and-mouth disease virus (FMDV) can infect domestic and wild cloven-hoofed animals. The non-structural protein 3D plays an important role in FMDV replication and pathogenesis. However, the interaction partners of 3D, and the effects of those interactions on FMDV replication, remain
Claudia Ribeiro de Almeida et al.
Molecular cell, 70(4), 650-662 (2018-05-08)
Class switch recombination (CSR) at the immunoglobulin heavy-chain (IgH) locus is associated with the formation of R-loop structures over switch (S) regions. While these often occur co-transcriptionally between nascent RNA and template DNA, we now show that they also form
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.