추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DDX5(1655) , DDX5(1655)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hao Zhang et al.
Hepatology (Baltimore, Md.), 69(3), 1046-1063 (2018-10-04)
In hepatocellular carcinoma (HCC), dysregulated expression of DDX5 (DEAD box protein 5) and impaired autophagy have been reported separately. However, the relationship between them has not been explored. Here we present evidence to show that, by interacting with autophagic receptor
Zheng Xing et al.
RNA (New York, N.Y.), 23(7), 1125-1138 (2017-04-16)
DEAD-box proteins are a class of nonprocessive RNA helicases that dynamically modulate the structure of RNA and ribonucleoprotein complexes (RNPs). However, the precise roles of individual members are not well understood. Work from our laboratory revealed that the DEAD-box protein
Nazia Abbasi et al.
Life science alliance, 3(10) (2020-08-21)
Tumorigenesis in different segments of the intestinal tract involves tissue-specific oncogenic drivers. In the colon, complement component 3 (C3) activation is a major contributor to inflammation and malignancies. By contrast, tumorigenesis in the small intestine involves fatty acid-binding protein 1
Yeon J Lee et al.
Genes & development, 32(15-16), 1060-1074 (2018-07-26)
Alternative premessenger RNA (pre-mRNA) splicing is a post-transcriptional mechanism for controlling gene expression. Splicing patterns are determined by both RNA-binding proteins and nuclear pre-mRNA structure. Here, we analyzed pre-mRNA splicing patterns, RNA-binding sites, and RNA structures near these binding sites
Peter Hoch-Kraft et al.
Journal of cell science, 131(9) (2018-04-07)
In the central nervous system, oligodendroglial expression of myelin basic protein (MBP) is crucial for the assembly and structure of the myelin sheath. MBP synthesis is tightly regulated in space and time, particularly at the post-transcriptional level. We have identified
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.