설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAAGGACATCCTGGGTGAAGCAGGGCTACACTTTGATGAACTGAACAAGCTGAGGGTGTTGGACCCAGAGGTTACCCAGCAGACCATAGAGCTGAAGGAAGAGTGCAAAGACTTTGTGGACAAAATTGGCCAGTTTCAGAAAATAGTTGGTGGTTTAATTGAGCTTGTTGATCAACTTGCAAAAGAAGCAGAAAATGAAAAGATGAAGAGTCTTGCTGTGTCACCCAGGCTGGAGTGCACTGGTGCAATCTCGGCTCACTGCAAGCTCTGCCTCTCAGATTCAAGCGATTCTCCCACCTCACCCTCCCGAGTAGGTGGGACTACAGGCCATCGGTGCTCGGAACTTGCTCAAATCTATAGCAAAGCAGAGAGAAGCTCAACAGCAGCAACTTCAAGCCCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IFT20(90410) , IFT20(90410)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Megumi Kitami et al.
Biochemical and biophysical research communications, 509(1), 222-226 (2018-12-28)
Condylar cartilage is a joint cartilage essential for smooth jaw movement. The importance of ciliary proteins in condylar cartilage development has been reported. However, little is known about how ciliary proteins control the homeostasis of condylar cartilage. Here we show
Francesca Finetti et al.
Cell death and differentiation, 27(1), 310-328 (2019-05-31)
The assembly and function of the primary cilium depends on multimolecular intraflagellar transport (IFT) complexes that shuttle their cargo along the axonemal microtubules through their interaction with molecular motors. The IFT system has been moreover recently implicated in a reciprocal
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.