설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGCAACATCCTTGTCAACAGCAACCTGGTCTGCAAAGTCTCAGACTTTGGCCTCTCCCGCTTCCTGGAGGATGACCCCTCCGATCCTACCTACACCAGTTCCCTGGGCGGGAAGATCCCCATCCGCTGGACTGCCCCAGAGGCCATAGCCTATCGGAAGTTCACTTCTGCTAGTGATGTCTGGAGCTACGGAATTGTCATGTGGGAGGTCATGAGCTATGGAGAGCGACCCTACTGGGACATGAGCAACCAGGATGTCATCAATGCCGTGGAGCAGGATTACCGGCTGCCACCACCCATGGACTGTCCCACAGCACTGCACCAGCTCATGCTGGACTGCTGGGTGCGGGACCGGAACCTCAGGCCCAAATTCTCCCAGATTGTCAATACCCTGGACAAGCTCATCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... EPHB3(2049) , EPHB3(2049)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Guodong Zhang et al.
Cancer science, 108(3), 408-418 (2017-04-04)
microRNAs play key roles during various crucial cell processes such as proliferation, migration, invasion and apoptosis. Also, microRNAs have been shown to possess oncogenic and tumor-suppressive functions in human cancers. Here, we describe the regulation and function of miR-149 in
Seong Hye Park et al.
Theranostics, 9(8), 2235-2251 (2019-06-01)
A major problem of colorectal cancer (CRC) targeted therapies is relapse caused by drug resistance. In most cases of CRC, patients develop resistance to anticancer drugs. Cetuximab does not show many of the side effects of other anticancer drugs and
Benjamin Lin et al.
Nature communications, 6, 6619-6619 (2015-04-09)
Directed cell migration in native environments is influenced by multiple migratory cues. These cues may include simultaneously occurring attractive soluble growth factor gradients and repulsive effects arising from cell-cell contact, termed contact inhibition of locomotion (CIL). How single cells reconcile
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.