콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU120781

Sigma-Aldrich

MISSION® esiRNA

targeting human CNR2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCTGGGTGACAGAGATAGCCAATGGCTCCAAGGATGGCTTGGATTCCAACCCTATGAAGGATTACATGATCCTGAGTGGTCCCCAGAAGACAGCTGTTGCTGTGTTGTGCACTCTTCTGGGCCTGCTAAGTGCCCTGGAGAACGTGGCTGTGCTCTATCTGATCCTGTCCTCCCACCAACTCCGCCGGAAGCCCTCATACCTGTTCATTGGCAGCTTGGCTGGGGCTGACTTCCTGGCCAGTGTGGTCTTTGCATGCAGCTTTGTGAATTTCCATGTTTTCCATGGTGTGGATTCCAAGGCTGTCTTCCTGCTGAAGATTGGCAGCGTGACTATGACCTTCACAGCCTCTGTGGGTAGCCTCCTGCTGACCGCCATTGACCGATACCTCTGCCTGCGCTATCCACCTTCCTACAAAGCTCTGCTCACCCGTGGAAGGGCACTGGTGACCCTGGGCATCATGTGGGTCCTCTCAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Young Sun Hwang et al.
Chemico-biological interactions, 273, 107-114 (2017-06-12)
Melanogenesis plays a critical role in the protection of skin against external stresses such as ultraviolet irradiation and oxidative stressors. This study was aimed to investigate the effects of cannabidiol on melanogenesis and its mechanisms of action in human epidermal
Sabrina Fechtner et al.
Clinical and experimental rheumatology, 37(6), 1026-1035 (2019-04-04)
Recent studies showed that the expression of cannabinoid receptor 2 (CB2), not CB1, is upregulated at both the mRNA and protein levels in rheumatoid arthritis synovial fibroblasts (RASFs), however, little is known about its endogenous role in pro-inflammatory cytokine signalling
Sabrina Fechtner et al.
Frontiers in immunology, 10, 1027-1027 (2019-05-30)
Management of pain in the treatment of rheumatoid arthritis (RA) is a priority that is not fully addressed by the conventional therapies. In the present study, we evaluated the efficacy of cannabinoid receptor 2 (CB2) agonist JWH-015 using RA synovial
Lei Tian et al.
Frontiers in immunology, 8, 1214-1214 (2017-10-17)
Macrophage M1/M2 polarization mediates tissue damage and inflammatory responses. Cannabinoid receptor (CB) 1 participated in liver fibrogenesis by affecting bone marrow (BM)-derived monocytes/macrophages (BMMs) activation. However, the knowledge of whether CB1 is involved in the polarization of BMMs remains limited.
Ryosuke Kamikubo et al.
Molecular nutrition & food research, 60(10), 2228-2242 (2016-05-29)
Nonalcoholic fatty liver disease is currently the most common chronic liver disease worldwide, characterized by excessive hepatic lipid accumulation without significant ethanol consumption. We have performed a screening for medicinal foods that inhibit hepatocytic lipid accumulation through activation of AMP-activated

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.