콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU115021

Sigma-Aldrich

MISSION® esiRNA

targeting human NF1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TATGGATCGGCTGTTGTCCTTAATGGTGTGTAACCATGAGAAAGTGGGACTTCAAATACGGACCAATGTTAAGGATCTGGTGGGTCTAGAATTGAGTCCTGCTCTGTATCCAATGCTATTTAACAAATTGAAGAATACCATCAGCAAGTTTTTTGACTCCCAAGGACAGGTTTTATTGACTGATACCAATACTCAATTTGTAGAACAAACCATAGCTATAATGAAGAACTTGCTAGATAATCATACTGAAGGCAGCTCTGAACATCTAGGGCAAGCTAGCATTGAAACAATGATGTTAAATCTGGTCAGGTATGTTCGTGTGCTTGGGAATATGGTCCATGCAATTCAAATAAAAACGAAACTGTGTCAATTAGTTGAAGTAATGATGGCAAGGAGAGATGACC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dana Rabara et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(44), 22122-22131 (2019-10-16)
KRAS mutations occur in ∼35% of colorectal cancers and promote tumor growth by constitutively activating the mitogen-activated protein kinase (MAPK) pathway. KRAS mutations at codons 12, 13, or 61 are thought to prevent GAP protein-stimulated GTP hydrolysis and render KRAS-mutated
K Mellert et al.
Scientific reports, 8(1), 6171-6171 (2018-04-20)
In Neurofibromatosis 1 (NF1) germ line loss of function mutations result in reduction of cellular neurofibromin content (NF1+/-, NF1 haploinsufficiency). The Ras-GAP neurofibromin is a very large cytoplasmic protein (2818 AA, 319 kDa) involved in the RAS-MAPK pathway. Aside from regulation
Ritsuko Harigai et al.
Scientific reports, 8(1), 6069-6069 (2018-04-19)
Neurofibromatosis type 1 (NF1) is caused by germline mutations in the NF1 gene and is characterized by café au lait spots and benign tumours known as neurofibromas. NF1 encodes the tumour suppressor protein neurofibromin, which negatively regulates the small GTPase
Ze-Yi Zheng et al.
Cancer cell, 37(3), 387-402 (2020-03-07)
We report that neurofibromin, a tumor suppressor and Ras-GAP (GTPase-activating protein), is also an estrogen receptor-α (ER) transcriptional co-repressor through leucine/isoleucine-rich motifs that are functionally independent of GAP activity. GAP activity, in turn, does not affect ER binding. Consequently, neurofibromin
Lionel Larribere et al.
Pigment cell & melanoma research, 28(4), 407-416 (2015-04-01)
Neurofibromatosis type 1 (NF1) is a frequent genetic disease leading to the development of Schwann cell-derived neurofibromas or melanocytic lesions called café-au-lait macules (CALMs). The molecular mechanisms involved in CALMs formation remain largely unknown. In this report, we show for

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.