추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGTGGGTGAATCTGGATTGGGAAAGTCGACATTAATCAACTCATTATTCCTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCATAGAATTAAAAAGACTGTACAGGTGGAACAATCCAAAGTTTTAATCAAAGAAGGTGGTGTTCAGTTGCTGCTCACAATAGTTGATACCCCAGGATTTGGAGATGCAGTGGATAATAGTAATTGCTGGCAGCCTGTTATCGACTACATTGATAGTAAATTTGAGGACTACCTAAATGCAGAATCACGAGTGAACAGACGTCAGATGCCTGATAACAGGGTGCAGTGTTGTTTATACTTCATTGCTCCTTCAGGACATGGACTTAAACCATTGGATATTGAGTTTATGAAGCGTTTGCATGAAAAAGTGAATATCATCCCACTTATTGCCAAAGCAGACACACTCACACCAGAGGAATGCCAACAGTT
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SEPT7(989) , SEPT7(989)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Sina Krokowski et al.
Journal of cell science, 132(9) (2019-04-18)
Pathogenic Shigella bacteria are a paradigm to address key issues of cell and infection biology. Polar localisation of the Shigella autotransporter protein IcsA is essential for actin tail formation, which is necessary for the bacterium to travel from cell-to-cell; yet
Sonja Kühn et al.
Cell reports, 31(6), 107638-107638 (2020-05-14)
The enteroinvasive bacterium Shigella flexneri forces its uptake into non-phagocytic host cells through the translocation of T3SS effectors that subvert the actin cytoskeleton. Here, we report de novo actin polymerization after cellular entry around the bacterium-containing vacuole (BCV) leading to
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.