추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAGAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TARDBP(23435) , TARDBP(23435)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 1
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xiaowei Chen et al.
Protein & cell, 9(10), 848-866 (2017-09-28)
Aberrant regulation of miRNA genes contributes to pathogenesis of a wide range of human diseases, including cancer. The TAR DNA binding protein 43 (TDP-43), a RNA/DNA binding protein associated with neurodegeneration, is involved in miRNA biogenesis. Here, we systematically examined
Seiichi Nagano et al.
Acta neuropathologica, 140(5), 695-713 (2020-08-18)
Mislocalization and abnormal deposition of TDP-43 into the cytoplasm (TDP-43 proteinopathy) is a hallmark in neurons of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). However, the pathogenic mechanism of the diseases linked to TDP-43 is largely unknown. We
Michael E Ward et al.
The Journal of experimental medicine, 211(10), 1937-1945 (2014-08-27)
Frontotemporal dementia (FTD) is the most common cause of dementia in people under 60 yr of age and is pathologically associated with mislocalization of TAR DNA/RNA binding protein 43 (TDP-43) in approximately half of cases (FLTD-TDP). Mutations in the gene
Giuseppe Militello et al.
Journal of molecular cell biology, 10(2), 102-117 (2018-04-05)
Myogenesis is a complex process required for skeletal muscle formation during embryonic development and for regeneration and growth of myofibers in adults. Accumulating evidence suggests that long non-coding RNAs (lncRNAs) play key roles in regulating cell fate decision and function
Alexander Gulliver Bjørnholt Grønning et al.
Nucleic acids research, 48(13), 7099-7118 (2020-06-20)
Nucleotide variants can cause functional changes by altering protein-RNA binding in various ways that are not easy to predict. This can affect processes such as splicing, nuclear shuttling, and stability of the transcript. Therefore, correct modeling of protein-RNA binding is
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.