콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU107771

Sigma-Aldrich

MISSION® esiRNA

targeting human IFITM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTGGTCCCTGGCTAATTCACCAATTTACAAACAGCAGGAAATAGAAACTTAAGAGAAATACACACTTCTGAGAAACTGAAACGACAGGGGAAAGGAGGTCTCACTGAGCACCGTCCCAGCATCCGGACACCACAGCGGCCCTTCGCTCCACGCAGAAAACCACACTTCTCAAACCTTCACTCAACACTTCCTTCCCCAAAGCCAGAAGATGCACAAGGAGGAACATGAGGTGGCTGTGCTGGGGCCACCCCCCAGCACCATCCTTCCAAGGTCCACCGTGATCAACATCCACAGCGAGACCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCTTGAACTGGTGCTGTCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCAT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hosni A M Hussein et al.
Scientific reports, 7(1), 17972-17972 (2017-12-23)
Kaposi's sarcoma-associated herpesvirus (KSHV) is etiologically associated with all forms of Kaposi's sarcoma worldwide. Little is currently known about the role of microRNAs (miRNAs) in KSHV entry. We recently demonstrated that KSHV induces a plethora of host cell miRNAs during
Hosni A M Hussein et al.
Scientific reports, 8(1), 14105-14105 (2018-09-22)
The oncogenic gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma herpesvirus (KSHV), are etiologically associated with a variety of human cancers, including Burkitt's lymphoma (BL), Hodgkin lymphoma (HL), Kaposi's sarcoma (KS), and primary effusion lymphoma (PEL). Recently, we demonstrated KSHV infection
Bo Feng et al.
Virology journal, 14(1), 213-213 (2017-11-05)
Endothelial cells are believed to play an important role in response to virus infection. Our previous microarray analysis showed that H9N2 virus infection and inactivated viral particle inoculation increased the expression of interferon-inducible transmembrane protein 1 (IFITM1) in human umbilical
Ying-Ying Xu et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)
Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.