설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTGTACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATGATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGCCAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTAATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... JAK3(3718)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jung Seok Kim et al.
International journal of nanomedicine, 13, 4817-4830 (2018-09-15)
Efficient target-specific siRNA delivery has always been a primary concern in the field of siRNA clinical application. In this study, four different types of anti-epidermal growth factor receptor (EGFR) antibody-conjugated immunonanoparticles were prepared and tested for cancer cell-targeted therapeutic siRNA
Nina A Sibbesen et al.
Oncotarget, 6(24), 20555-20569 (2015-08-06)
Aberrant activation of Janus kinase-3 (Jak3) and its key down-stream effectors, Signal Transducer and Activator of Transcription-3 (STAT3) and STAT5, is a key feature of malignant transformation in cutaneous T-cell lymphoma (CTCL). However, it remains only partially understood how Jak3/STAT
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.