설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAAGATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGAAGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACACAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTACCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAATCCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCC
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NCAM1(4684) , NCAM1(4684)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yongguang Yang et al.
BMC cell biology, 11, 78-78 (2010-10-20)
The proliferation and final density of Sertoli cells in the testis are regulated by hormones and local factors. Glial cell line-derived neurotrophic factor (GDNF), a distantly related member of the transforming growth factor-β superfamily, and its receptor subunits GDNF family
Natacha Coppieters et al.
Brain research, 1710, 199-208 (2018-12-26)
The neural cell adhesion molecule (NCAM) is a transmembrane protein involved in major cellular processes. The addition of polysialic acid (PSA), a post-translational modification (PTM) almost exclusively carried by NCAM, alters NCAM properties and functions and is therefore tightly regulated.
Chunlei Yu et al.
Toxicology mechanisms and methods, 26(9), 635-643 (2016-11-08)
Curcuma phaeocaulis Val. is a Chinese medicinal herb that is contraindicated during pregnancy for over a thousand years in China. The aims of the present study were to evaluate the effect of curcumol (one of the major components of C.
Mizuki Sumida et al.
The Journal of biological chemistry, 290(21), 13202-13214 (2015-03-10)
As acidic glycocalyx on primary mouse microglial cells and a mouse microglial cell line Ra2, expression of polysialic acid (polySia/PSA), a polymer of the sialic acid Neu5Ac (N-acetylneuraminic acid), was demonstrated. PolySia is known to modulate cell adhesion, migration, and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.