설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SKP2(6502) , SKP2(6502)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Shirly Lahav-Baratz et al.
Reproductive biomedicine online, 32(3), 308-315 (2016-01-23)
This preliminary study examined a possible effect of long duration repeated hormonal stimulation on the endometrium using a molecular tool. The expression of the hormone stimulated, cell cycle regulators, p27 and its ligase S-phase kinase-interacting protein2 (Skp2), were assessed in
Wei Yan et al.
Cancer biotherapy & radiopharmaceuticals, 34(7), 451-458 (2019-04-27)
Background: Mantle cell lymphoma (MCL) is associated with poor patient prognosis mainly due to incomplete response to chemotherapy. S-phase
Yingduan Cheng et al.
Oncotarget, 8(2), 1972-1982 (2016-12-29)
Recent findings on the existence of oncogenic fusion genes in a wide array of solid tumors, including head and neck squamous cell carcinoma (HNSCC), suggests that fusion genes have become attractive targets for cancer diagnosis and treatment. In this study
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.