설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGCTGTTCCTCATCTGTGCTTATCAGAATAACAAAGAACTCTTGTCTAAAGGCTTATACAGAGGACATGATGAAGAATTGATATCACATTATAGAAGAGAATGTTTGCTAAAATTAAATGAGCAAGCCGCAGAACTCTTCGAATCTGGAGAGGATCGAGAAGTAAACAATGGTTTGATTATCATGAATGAGTTTATTGTCCCATTTTTGCCATTATTACTGGTGGATGAAATGGAAGAAAAGGATATACTAGCTGTAGAAGATATGAGAAATCGATGGTGTTCCTACCTTGGTCAAGAAATGGAACCACACCTCCAAGAAAAGCTGACAGATTTTTTGCCAAAACTGCTTGATTGTTCTATGGAGATTAAAAGTTTCCATGAGCCACCGAAGTTACCTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... USP25(29761) , USP25(29761)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jian Wen et al.
Molecular immunology, 106, 53-62 (2018-12-24)
The inhibition of tumor necrosis factor receptor-associated factor 3 (TRAF3) degradation induces endotoxin tolerance (ET) in macrophages. However, the mechanisms leading to TRAF3 inhibition by ET are largely unknown. Here, we found that ubiquitin-specific peptidase 25 (USP25), a deubiquitinating enzyme
Changyu Ding et al.
Canadian journal of physiology and pharmacology, 95(5), 481-491 (2017-01-31)
Lipopolysaccharide (LPS) is a key pathogenic factor in sepsis, and its recognition by toll-like receptor 4 (TLR4) can activate two district signaling pathways, leading to activation of transcription factors including NF-κB and interferon regulatory factor 3 (IRF3). Chloroquine (CQ) has
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.