추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGACAAGAGGTGGCCATAAAGCAGATGAACCTTCAACAGCAACCCAAGAAGGAATTAATTATTAATGAAATTCTGGTCATGAGGGAAAATAAGAACCCTAATATTGTTAATTATTTAGATAGCTACTTGGTGGGTGATGAACTATGGGTAGTCATGGAATACTTGGCTGGTGGCTCTCTGACTGATGTGGTCACAGAGACCTGTATGGATGAAGGACAGATAGCAGCTGTCTGCAGAGAGTGCCTGCAAGCTTTGGATTTCCTGCACTCAAACCAGGTGATCCATAGAGATATAAAGAGTGACAATATTCTTCTCGGGATGGATGGCTCTGTTAAATTGACTGACTTTGGGTTCTGTGCCCAGATCACTCCTGAGCAAAGTAAACGAAGCACTATGGTGGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PAK3(5063) , PAK3(5063)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hui Zhu et al.
Stem cells (Dayton, Ohio), 32(8), 2098-2110 (2014-04-18)
In mammalian embryos, embryonic stem cells (ESCs) and induced pluripotent cells, a shortened G1 phase is correlated with the pluripotent state. To molecularly define this phase, we compared transcripts from the shortened G1 of human ESCs (hESCs) with those from
Rosaura Esteve-Puig et al.
PLoS genetics, 10(10), e1004721-e1004721 (2014-10-21)
Exposure to ultraviolet (UV) radiation from sunlight accounts for 90% of the symptoms of premature skin aging and skin cancer. The tumor suppressor serine-threonine kinase LKB1 is mutated in Peutz-Jeghers syndrome and in a spectrum of epithelial cancers whose etiology
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.