콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU086811

Sigma-Aldrich

MISSION® esiRNA

targeting human SYT1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCCATATAGTGCTCTTTAGCCAGTATCTGTAAATACCTCAGTAATATGGGTCCTTTCATTTTTCCAGCCATGCATTCCTAACACAATTCAGTGGTACTTGGAATCCTGTTTTAATTTGCACAAATTTAAATGTAGAGAGCCCCTAAGTCCTTCATCATACCACTGCCCTCCAAATCTACTCTTCTTTTAAGCAATATGATGTGTAGATAGAGCATGAATGAAATTATTTATTGTATCACACTGTTGTATATACCAGTATGCTAAAGATTTATTTCTAGTTTGTGTATTTGTATGTTGTAAGCGTTTCCTAATCTGTGTATATCTAGATGTTTTTAATAAGATGTTCTATTTTAAACTATGTAAATTGACTGAGATATAGGAGAGCTGATAATATATTATACGGTAAATATAGTATCGTCTGCATTCCAGCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Feng Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 699-712 (2018-04-06)
Necroptosis, a form of programmed necrosis, is involved in the pathologic process of several kinds of pulmonary diseases. However, the role of necroptosis in particulate matter (PM)-induced pulmonary injury remains unclear. The objective of this study is to investigate the
Yang Xiao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(5 Pt A), 1728-1743 (2018-02-25)
Diabetic cardiomyopathy is associated with suppressed autophagy and augmented inflammation in the heart. The effects of Tax1 binding protein 1 (TAX1BP1) on both autophagy and inflammation suggest that it may participate in the progression of diabetic cardiomyopathy. Mice were injected
Changping Gu et al.
Shock (Augusta, Ga.), 44(1), 83-89 (2015-03-24)
Recombinant human annexin A5 (Anx5) is known to protect cardiac function during endotoxemia, although the underlying mechanisms have yet to be elucidated. In this study, we demonstrated that Anx5 could repair the disrupted cardiomyocyte adherens junctions and improve the myocardial
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Y Loriot et al.
Cell death & disease, 5, e1423-e1423 (2014-09-19)
Radiotherapy has a critical role in the treatment of small-cell lung cancer (SCLC). The effectiveness of radiation in SCLC remains limited as resistance results from defects in apoptosis. In the current study, we investigated whether using the Bcl-2/Bcl-XL inhibitor S44563

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.