설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAGAGCAGAGCGTGAACTACGAAGCATTCCAGAAGACTCAGAGTTAAATACAGTTACATTGCCAAGAAAAGCAAGAATGAAAGACCAGTTTGGCAATTCTATTATCAACACACCTCTGAAACGTCGTAAAGTGTTTTCTCAAGAACCTCCAGATGCTTTAGCTTTAAGCTGCCAAAGTTCCTTTGACAGTGTCATTTTAAACTGTCGAAGTATACGAGTAGGAACACTCTTCCGGCTGTTAATAGAGCCTGTAATTTTTTGTTTAGATTTTATCAAGATACAGCTAGACGAACCAGACCATGATCCTGTAGAGATTATATTAAATACCTCTGATCTAACTAAATGTGAATGGTGTAATGTCCGAAAATTACCTGTAGTGTTTCTTCAAGCAATTCCAGCAGTTTATCAAAAGCTGAGCATCCAACTGCAAATGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SENP6(26054) , SENP6(26054)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Neil Hattersley et al.
Molecular biology of the cell, 22(1), 78-90 (2010-12-15)
Promyelocytic leukemia protein (PML) is the core component of PML-nuclear bodies (PML NBs). The small ubiquitin-like modifier (SUMO) system (and, in particular, SUMOylation of PML) is a critical component in the formation and regulation of PML NBs. SUMO protease SENP6
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.