설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGAGAGAGAGAATGGGAACGGGAAGTGCTGGGCATAAAGCGAGACAAGAGTGACAGCCCTGCCATTCAGCTACGTCTCAAAGAACCTATGGATGTTGATGTAGAAGATTATTACCCAGCTTTCCTGGACATGGTGCGGAGCCTGCTGGATGGCAACATAGACTCATCACAGTATGAAGATTCACTGAGAGAGATGTTCACCATTCATGCCTACATTGCCTTTACCATGGACAAACTGATCCAGAGCATTGTCAGACAGCTGCAGCATATCGTGAGTGATGAGATCTGTGTGCAGGTGACTGACCTTTACCTGGCAGAAAATAATAATGGGGCCACCGGAGGCCAGCTGAACACACAGAACTCAAGGAGCCTCCTGGAGTCAACGTATCAGCGGAAAGCTGAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SIN3A(25942) , SIN3A(25942)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jie Ren et al.
Experimental and therapeutic medicine, 18(4), 2565-2573 (2019-09-27)
Previous studies have indicated that microRNA (miR)-210-3p is upregulated in NSCLC, however, the specific mechanism underlying the role of miR-210-3p in NSCLC pathogenesis requires further investigation. The aim of the present study was to explore the roles of miR-210-3p in
Giovanni Gambi et al.
Cancer research, 79(12), 3076-3087 (2019-01-30)
Epigenetic silencing of promoter and enhancer regions is a common phenomenon in malignant cells. The transcription factor STAT3 is aberrantly activated in several tumors, where its constitutive acetylation accounts for the transcriptional repression of a number of tumor suppressor genes
Sweta Srivas et al.
Journal of neurochemistry, 145(3), 204-216 (2018-03-02)
Epigenetic modifications through methylation of DNA and acetylation of histones modulate neuronal gene expression and regulate long-term memory. Earlier we demonstrated that scopolamine-induced decrease in memory consolidation is correlated with enhanced expression of hippocampal DNA methyltransferase 1 (DNMT1) and histone
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.