콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081441

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK14

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCAT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yu Wang et al.
Oncology reports, 39(1), 61-70 (2017-11-09)
Photodynamic therapy (PDT) is considered to be an advancing antitumor technology. PDT using hydrophilic/lipophilic tetra‑α-(4-carboxyphenoxy) phthalocyanine zinc (TαPcZn-PDT) has exhibited antitumor activity in Bel-7402 hepatocellular cancer cells. However, the manner in which p38 MAPK and caspase-9 are involved in the regulation
Y Kim et al.
The British journal of dermatology, 179(3), 689-701 (2018-02-28)
Adiponectin is an adipocyte-derived cytokine that circulates as a full-length protein and a fragment containing the globular domain of adiponectin (gAd). A recent study has reported the antimelanogenic effects of full-length adiponectin. To examine the involvement of gAd in melanogenesis
Zhe Zhang et al.
Virology, 508, 150-158 (2017-05-26)
Enterovirus71 (EV71) is the major causative agent of hand, foot and mouth disease, which threatens the health of infants and young children. The expression of inflammatory cytokines induced by this viral infection aggravate the illness. Here, we describe the anti-EV71
Yumei Yan et al.
Scientific reports, 6, 37052-37052 (2016-11-16)
Hepatocellular carcinoma (HCC) is refractory to chemotherapies, necessitating novel effective agents. The lysosome inhibitor Bafilomycin A1 (BafA1) at high concentrations displays cytotoxicity in a variety of cancers. Here we show that BafA1 at nanomolar concentrations suppresses HCC cell growth in
Yuan-Yuan Shang et al.
Oncotarget, 8(63), 107076-107088 (2018-01-02)
We investigated the efficacy of Alisertib (ALS), a selective Aurora kinase A (AURKA) inhibitor, in melanoma. We found that ALS exerts anti-proliferative, pro-apoptotic, and pro-autophagic effects on A375 and skmel-5 melanoma cells by inhibiting p38 MAPK signaling. SB202190, a p38

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.