추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MAPK14(1432) , MAPK14(1432)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yu Wang et al.
Oncology reports, 39(1), 61-70 (2017-11-09)
Photodynamic therapy (PDT) is considered to be an advancing antitumor technology. PDT using hydrophilic/lipophilic tetra‑α-(4-carboxyphenoxy) phthalocyanine zinc (TαPcZn-PDT) has exhibited antitumor activity in Bel-7402 hepatocellular cancer cells. However, the manner in which p38 MAPK and caspase-9 are involved in the regulation
Y Kim et al.
The British journal of dermatology, 179(3), 689-701 (2018-02-28)
Adiponectin is an adipocyte-derived cytokine that circulates as a full-length protein and a fragment containing the globular domain of adiponectin (gAd). A recent study has reported the antimelanogenic effects of full-length adiponectin. To examine the involvement of gAd in melanogenesis
Zhe Zhang et al.
Virology, 508, 150-158 (2017-05-26)
Enterovirus71 (EV71) is the major causative agent of hand, foot and mouth disease, which threatens the health of infants and young children. The expression of inflammatory cytokines induced by this viral infection aggravate the illness. Here, we describe the anti-EV71
Yumei Yan et al.
Scientific reports, 6, 37052-37052 (2016-11-16)
Hepatocellular carcinoma (HCC) is refractory to chemotherapies, necessitating novel effective agents. The lysosome inhibitor Bafilomycin A1 (BafA1) at high concentrations displays cytotoxicity in a variety of cancers. Here we show that BafA1 at nanomolar concentrations suppresses HCC cell growth in
Alisertib promotes apoptosis and autophagy in melanoma through p38 MAPK-mediated aurora a signaling.
Yuan-Yuan Shang et al.
Oncotarget, 8(63), 107076-107088 (2018-01-02)
We investigated the efficacy of Alisertib (ALS), a selective Aurora kinase A (AURKA) inhibitor, in melanoma. We found that ALS exerts anti-proliferative, pro-apoptotic, and pro-autophagic effects on A375 and skmel-5 melanoma cells by inhibiting p38 MAPK signaling. SB202190, a p38
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.