콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081301

Sigma-Aldrich

MISSION® esiRNA

targeting human RACGAP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGGTCATTGTTGGGAGCTTTTAGATGAGACATCTTTCCAGGGGTAGAAGGGTTAGTATGGAATTGGTTGTGATTCTTTTTGGGGAAGGGGGTTATTGTTCCTTTGGCTTAAAGCCAAATGCTGCTCATAGAATGATCTTTCTCTAGTTTCATTTAGAACTGATTTCCGTGAGACAATGACAGAAACCCTACCTATCTGATAAGATTAGCTTGTCTCAGGGTGGGAAGTGGGAGGGCAGGGCAAAGAAAGGATTAGACCAGAGGATTTAGGATGCCTCCTTCTAAGAACCAGAAGTTCTCATTCCCCATTATGAACTGAGCTATAATATGGAGCTTTCATAAAAATGGGATGCATTGAGGACAGAACTAGTGATGGGAGTATGCGTAGCTTTGATTTGGATGATTAGGTCTTTAATAGTGTTGAGTGGCACAACCTTG

Ensembl | 인체 수납 번호

ENSG00000161800

NCBI 수납 번호

NM_013277

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RACGAP1(29127) , RACGAP1(29127)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xinchun Ding et al.
Oncotarget, 8(18), 30123-30137 (2017-04-19)
Lysosomal acid lipase (LAL) is a critical neutral lipid metabolic enzyme that regulates metabolic reprogramming in myeloid-derived suppressor cells (MDSCs) through over-activation of mammalian target of rapamycin (mTOR). Affymetrix GeneChip microarray analysis of MDSCs from LAL deficient mouse (lal-/-) revealed
Matthew L Kutys et al.
Nature cell biology, 16(9), 909-917 (2014-08-26)
Rho-family GTPases govern distinct types of cell migration on different extracellular matrix proteins in tissue culture or three-dimensional (3D) matrices. We searched for mechanisms selectively regulating 3D cell migration in different matrix environments and discovered a form of Cdc42-RhoA crosstalk
Arjan J van Adrichem et al.
FEBS letters, 589(24 Pt B), 3859-3865 (2015-11-26)
Male germ cell Rac GTPase-activating protein (MgcRacGAP) is a core regulator of cytokinesis. Furthermore, it appears to be involved in human oncogenesis through cytokinesis-independent mechanisms and has been reported to be essential for nuclear translocation of signal transducer and activator
Toshiyuki Kawashima et al.
The Journal of cell biology, 175(6), 937-946 (2006-12-21)
STAT transcription factors are tyrosine phosphorylated upon cytokine stimulation and enter the nucleus to activate target genes. We show that Rac1 and a GTPase-activating protein, MgcRacGAP, bind directly to p-STAT5A and are required to promote its nuclear translocation. Using permeabilized

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.