설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCGCCTCTCCCTCAGTTATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGTATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTTTTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAAGCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTAACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAATCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCAGCCTGGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... STEAP4(79689) , STEAP4(79689)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Overexpressing STAMP2 attenuates adipose tissue angiogenesis and insulin resistance in diabetic ApoE
Feng Wang et al.
Journal of cellular and molecular medicine, 21(12), 3298-3308 (2017-06-21)
The aim of this study was to investigate whether overexpression of STAMP2 improves insulin resistance by regulating angiogenesis in adipose tissues. The characteristics of diabetic mice were measured by serial metabolite and pathology tests. Samples were obtained from epididymal, subcutaneous
Yoo Jin Oh et al.
Molecular pharmacology, 94(6), 1401-1411 (2018-10-28)
Nonalcoholic fatty liver disease (NAFLD) is an increasingly studied condition that can progress to end-stage liver disease. Although NAFLD was first described in 1980, a complete understanding of the mechanism and causes of this disease is still lacking. Six-transmembrane protein
Hye Young Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12354-12366 (2020-07-29)
Although previous studies have shown that the administration of fibroblast growth factor 21 (FGF21) reverses hepatic steatosis, the mechanism by which FGF21 exerts a therapeutic effect on nonalcoholic fatty liver disease (NAFLD) is not yet entirely understood. We previously demonstrated
Sung Won Lee et al.
Bone research, 6, 20-20 (2018-07-14)
Free fatty acids (FFAs), which are elevated with metabolic syndrome, are considered the principal offender exerting lipotoxicity. Few previous studies have reported a causal relationship between FFAs and osteoarthritis pathogenesis. However, the molecular mechanism by which FFAs exert lipotoxicity and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.