설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCAGACATGAGATCCATCACTAATAATAGCTCAGATCCTTTCCTCAATGGAGGGCCATATCATTCGAGGGAGCAGAGCACTGACAGTGGCCTGGGGTTAGGGTGCTACAGTGTCCCCACAACTCCGGAGGACTTCCTCAGCAATGTGGATGAGATGGATACAGGAGAAAACGCAGGACAAACACCCATGAACATCAATCCCCAACAGACCCGTTTCCCTGATTTCCTTGACTGTCTTCCAGGAACAAACGTTGACTTAGGAACTTTGGAATCTGAAGACCTGATCCCCCTCTTCAATGATGTAGAGTCTGCTCTGAACAAAAGTGAGCCCTTTCTAACCTGGCTGTAATCACTACCATTGTAACTTGGATGTAGCCATGACCTTACATTTCCTGGGCCTCTTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... WWTR1(25937) , WWTR1(25937)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Libo Yan et al.
Archives of biochemistry and biophysics, 562, 31-36 (2014-08-01)
The Hippo-YAP pathway is altered and implicated as an oncogenic signaling pathway in many human cancers. Hypoxia is an important microenvironmental factor that promotes tumorigenesis. However, the effects of hypoxia on the two most important Hippo-YAP effectors, YAP (Yes-associated protein)
M Shanzer et al.
Oncogene, 34(32), 4190-4198 (2014-11-05)
The polyomavirus middle T antigen (PyMT) is an oncogene that activates the non-receptor tyrosine kinase, c-Src, and physically interacts with Taz (WWTR1). Taz is a pro-oncogenic transcription coactivator of the Tead transcription factors. The Hippo tumor suppressor pathway activates the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.