콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU078241

Sigma-Aldrich

MISSION® esiRNA

targeting human TJP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT

Ensembl | 인체 수납 번호

ENSG00000104067

NCBI 수납 번호

NM_003257

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TJP1(7082) , TJP1(7082)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
JUU
QCS
NRR
RPR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Alan S Fanning et al.
Molecular biology of the cell, 23(4), 577-590 (2011-12-23)
The structure and function of both adherens (AJ) and tight (TJ) junctions are dependent on the cortical actin cytoskeleton. The zonula occludens (ZO)-1 and -2 proteins have context-dependent interactions with both junction types and bind directly to F-actin and other
Wan-Qing Yu et al.
PloS one, 11(3), e0151668-e0151668 (2016-03-16)
In S334ter-line-3 rat model of Retinitis Pigmentosa (RP), rod cell death induces the rearrangement of cones into mosaics of rings while the fibrotic processes of Müller cells remodel to fill the center of the rings. In contrast, previous work established
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.