설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGTATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACGGGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCGGCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTGAAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGGATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAAGGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ARPC2(10109) , ARPC2(10109)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yae Jin Yoon et al.
Biochemical pharmacology, 163, 46-59 (2019-02-03)
Metastasis is the leading cause of cancer mortality and cancer cell migration is an essential stage of metastasis. We identified benproperine (Benp, a clinically used antitussive drug) as an inhibitor of cancer cell migration and an anti-metastatic agent. Benp selectively
Zhongle Cheng et al.
Oncology reports, 41(6), 3189-3200 (2019-04-20)
Actin-related protein 2/3 complex (ARPC2) is an actin‑binding component involved in the regulation of actin polymerization. It mediates the formation of branched actin networks and contacts the mother actin filament. Migration and invasion are key processes which enable tumor cells
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.