추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PRKAA1(5562) , PRKAA1(5562)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Cuiping Dai et al.
Oncotarget, 8(56), 95810-95823 (2017-12-10)
LB-100 is a novel PP2A inhibitor. Its activity in human colorectal cancer (CRC) cells was tested. The
Xue Han et al.
Oncogene, 38(38), 6537-6549 (2019-07-31)
Endometrial cancer (EC) is one of the most common gynecologic malignancies. However, the molecular mechanisms underlying the development and progression of EC remain unclear. Here, we demonstrated that the protein proviral insertion in murine lymphomas 2 (PIM2) was necessary for
Takuma Hashimoto et al.
Biochemical and biophysical research communications, 505(1), 13-19 (2018-09-19)
Solid tumors often contain hypoxic regions because an abnormal and inefficient tumor vasculature is unable to supply sufficient oxygen. Tissue hypoxia is generally defined as a low oxygen concentration of less than 2%. It is well known that tumor cells
Ying-Nan Wang et al.
Oncogene, 39(3), 637-650 (2019-09-19)
Patients with stage II or III colorectal cancer (CRC) exhibit various clinical outcomes after radical treatments. The 5-year survival rate was between 50 and 87%. However, the underlying mechanisms of the variation remain unclear. Here we show that AMPKα1 is
Javier Sáenz et al.
The Journal of nutritional biochemistry, 54, 48-56 (2017-12-16)
Liver X receptor alpha (LXRα) is a nuclear receptor involved in cholesterol homeostasis. Curcumin, a traditional Chinese derivative from the rhizomes of Curcuma longa and a well-known AMP-activated protein kinase (AMPK) activator, possess hypocholesterolemic activity, however, the possible link between
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.