설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGCTGGGGATTCAGCTCTAGAGGTCACAGTATCCTCGTTTGAAAGATAATTAAGATCCCCCGTGGAGAAAGCAGTGACACATTCACACAGCTGTTCCCTCGCATGTTATTTCATGAACATGACCTGTTTTCGTGCACTAGACACACAGAGTGGAACAGCCGTATGCTTAAAGTACATGGGCCAGTGGGACTGGAAGTGACCTGTACAAGTGATGCAGAAAGGAGGGTTTCAAAGAAAAAGGATTTTGTTTAAAATACTTTAAAAATGTTATTTCCTGCATCCCTTGGCTGTGATGCCCCTCTCCCGATTTCCCAGGGGCTCTGGGAGGGACCCTTCTAAGAAGATTGGGCAGTTGGGTTTCTGGCTTGAGATGAATCCAAGCAGCAGAATGAGCCAGGAGTAGCAGGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FOSL2(2355) , FOSL2(2355)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Shuo Li et al.
Experimental cell research, 373(1-2), 57-61 (2018-08-17)
Among different cancers, incidence and mortality of colorectal cancer (CRC) is one of the highest. KRAS mutation is one of the underlying features in the pathogenesis of CRC with CRC tumors harboring mutant KRAS exhibiting a more aggressive behavior compared
Lan Ling et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 411-419 (2018-05-23)
Hepatocyte proliferation and apoptosis are critical cellular behaviors in rat liver as a result of a liver injury. Herein, we performed this study in order to evaluate the role of miR-30e and its target Fos-Related Antigen-2 (FOSL2) in septic rats
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and
Jon M Carthy et al.
Journal of cellular physiology, 230(12), 3084-3092 (2015-06-23)
Transforming growth factor-β (TGF-β) is a multifunctional cytokine which stimulates the differentiation of fibroblasts into myofibroblasts. Myofibroblasts are critical for normal wound healing, but also accumulate pathologically in a number of chronic inflammatory conditions where they are key contributors to
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.