콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU072211

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCACCCTCAATGAGATGTTCCGCGAGGTTGAGGAACTGATGGAGGACACGCAGCACAAATTGCGCAGCGCGGTGGAAGAGATGGAGGCAGAAGAAGCTGCTGCTAAAGCATCATCAGAAGTGAACCTGGCAAACTTACCTCCCAGCTATCACAATGAGACCAACACAGACACGAAGGTTGGAAATAATACCATCCATGTGCACCGAGAAATTCACAAGATAACCAACAACCAGACTGGACAAATGGTCTTTTCAGAGACAGTTATCACATCTGTGGGAGACGAAGAAGGCAGAAGGAGCCACGAGTGCATCATCGACGAGGACTGTGGGCCCAGCATGTACTGCCAGTTTGCCAGCTTCCAGTACACCTGCCAGCCATGCCGGGGCCAGAGGATGCTCTGCACCCGGGACAGTGAGTGCTGTGGAGACCAGCTGTGTGTCTGGGGTCACTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bo Liu et al.
Experimental and therapeutic medicine, 18(6), 4747-4757 (2019-11-28)
MicroRNA-1303 (miR-1303) is involved in the tumorigenesis and progression of several cancers, and yet the role of miR-1303 in prostate cancer (PCa) and its underlying mechanism are unknown. To explore this issue, the present study aimed to use PCa tissues
Gang Peng et al.
Experimental and therapeutic medicine, 18(1), 769-778 (2019-07-02)
MicroRNAs (miRs) serve important roles in glioma. However, the underlying molecular mechanism of miR-25 in glioma progression remains largely unknown; therefore, it was investigated in the present study. RT-qPCR analysis revealed that miR-25 expression levels were markedly increased in human
Zainab Al Shareef et al.
Oncogene, 37(39), 5305-5324 (2018-06-03)
Aberrant transforming growth factor-β (TGF-β) signaling is a hallmark of the stromal microenvironment in cancer. Dickkopf-3 (Dkk-3), shown to inhibit TGF-β signaling, is downregulated in prostate cancer and upregulated in the stroma in benign prostatic hyperplasia, but the function of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.