콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU070821

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD4

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AATGAAGTTGCGGAAATGTTAAGAGATTTAAATCTTGGTGAAATGAAAAGTGGAGTACCAGTGTTGGCAGTATCCTTAGCATTGGAGGGGAAGGCTAGTCATAGAGAGATGACATCTAAGCTTCTTTCTGACCTTTGTGGGACAGTAATGAGCACAACTGATGTGGAAAAATCATTTGATAAATTGTTGAAAGATCTACCTGAATTAGCACTGGATACTCCTAGAGCACCACAGTTGGTGGGCCAGTTTATTGCTAGAGCTGTTGGAGATGGAATTTTATGTAATACCTATATTGATAGTTACAAAGGAACTGTAGATTGTGTGCAGGCTAGAGCTGCTCTGGATAAGGCTACCGTGCTTCTGAGTATGTCTAAAGGTGGAAAGCGTAAAGATAGTGTGTGGGGCTCTGG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Kun Wang et al.
Molecular medicine reports, 16(5), 6757-6763 (2017-09-14)
Contrast medium (CM) is widely used in cardiac catheterization; however, it may induce acute kidney injury or renal failure, although the underlying mechanism remains to be elucidated. MicroRNA‑21 (miR‑21) is involved in renal disease and has been indicated to regulate
Hongwei Liang et al.
Scientific reports, 6, 23772-23772 (2016-03-30)
Programmed cell death 4 (PDCD4), as a tumor suppressor gene, is frequently reduced in a variety of tumors, including gastric cancer. Previous findings have indicated that PDCD4 participates in tumorigenesis through the regulation of apoptosis, but the molecular basis of
Xiaodong Chen et al.
Anatomical record (Hoboken, N.J. : 2007), 302(8), 1399-1408 (2018-10-20)
Osteosarcoma (OS) is one of the most common malignancies of bone. This study was aimed to explore the anti-metastatic effect of euxanthone on OS. Adhesion assay and Transwell assay were used to examine the effect of euxanthone on adhesion, migration
Ken Watanabe et al.
PloS one, 15(2), e0226053-e0226053 (2020-02-11)
Hypertension is a major public health problem among the aging population worldwide. It causes cardiac remodeling, including hypertrophy and interstitial fibrosis, which leads to development of hypertensive heart disease (HHD). Although microRNA-21 (miR-21) is associated with fibrogenesis in multiple organs
Xiafei Fu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 670-682 (2018-07-20)
Several miRNAs have been reported to be involved in the pathogenesis of polycystic ovarian syndrome (PCOS). However, the biological roles of miR-16 and its molecular mechanisms in PCOS development remain to be elucidated. qRT-PCR was performed to detect the expression

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.