추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATCTTTGTTGCCCTCTCCTGCTTTGGCTCCATGAACGGTGGTGTGTTTGCTGTCTCCAGGTTATTCTATGTTGCGTCTCGAGAGGGTCACCTTCCAGAAATCCTCTCCATGATTCATGTCCGCAAGCACACTCCTCTACCAGCTGTTATTGTTTTGCACCCTTTGACAATGATAATGCTCTTCTCTGGAGACCTCGACAGTCTTTTGAATTTCCTCAGTTTTGCCAGGTGGCTTTTTATTGGGCTGGCAGTTGCTGGGCTGATTTATCTTCGATACAAATGCCCAGATATGCATCGTCCTTTCAAGGTGCCACTGTTCATCCCAGCTTTGTTTTCCTTCACATGCCTCTTCATGGTTGCCCTTTCCCTCTATTCGGACCCATTTAGTACAGGGATTGGCTTCGTCATCACT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SLC7A11(23657) , SLC7A11(23657)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Naisu Yang et al.
Journal of genetics, 97(2), 463-468 (2018-06-23)
Solute carrier family 7 member 11 (SLC7A11) is a cystine/glutamate exchanger, also known as xCT, has been found to play an important role in pheomelanin synthesis. Adjusting the cystine content of cells to influence pheomelanin synthesis affects the proportion of
Masaki Nagane et al.
PloS one, 13(4), e0195151-e0195151 (2018-04-13)
The sodium-independent cystine-glutamate antiporter plays an important role in extracellular cystine uptake. It comprises the transmembrane protein, xCT and its chaperone, CD98. Because glutathione is only weakly cell membrane permeable, cellular uptake of its precursor, cystine, is known to be
Chun Ge et al.
Scientific reports, 7(1), 3791-3791 (2017-06-21)
Adriamycin (ADR) induces the over-expression of P-glycoprotein (P-gp) and multiple drug resistance in breast cancer cells. However, the biochemical process and underlying mechanisms are not clear. Our previous study revealed that ADR increased reactive oxygen species (ROS) generation and decreased
Yu Li et al.
Oncology letters, 19(1), 323-333 (2020-01-04)
Non-small cell lung cancer (NSCLC) has long been one of the most lethal types of cancer due to its lack of typical clinical symptoms at early stages and high risk of tumour recurrence, even following complete surgical resection. Multicourse chemotherapy
Chaoli Huang et al.
Oncology reports, 40(4), 2363-2370 (2018-08-02)
The tumour‑suppressor protein p53 is a key regulator of multiple cellular processes and exerts its tumour‑suppressor function by inducing apoptotic cell death. However, emerging evidence indicates that p53 is also involved in inducing ferroptosis, which is a unique iron‑dependent form
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.